Difference between revisions of "D.nft"
(One intermediate revision by the same user not shown) | |||
Line 7: | Line 7: | ||
a bioart ethicist | a bioart ethicist | ||
a bioart science fiction writer | a bioart science fiction writer | ||
+ | |||
+ | Study the below art and science multimedia database entry to inform your commentary. | ||
+ | |||
+ | Please add to the D.nft entry by becoming a bioart critic, bioart ethicist or bioart science fiction writer by clicking one of the three links below: | ||
+ | |||
+ | Bioart Ethics - CGCB BioInfo Database Entry Form | ||
+ | |||
+ | https://mega.hackteria.org/index.php/apps/forms/bPTRLa5NAosYRd9K | ||
+ | |||
+ | Bioart Ethics - CGCB BioInfo Multimedia Database: | ||
+ | |||
+ | https://mega.hackteria.org/index.php/s/eEZSk63criQK7fd | ||
+ | |||
+ | |||
+ | Bioart Science Fiction - CGCB BioInfo Database Entry Form | ||
+ | |||
+ | https://mega.hackteria.org/index.php/apps/forms/goPy4ELMcGmFFbPw | ||
+ | |||
+ | Bioart Science Fiction - CGCB BioInfo Multimedia Database: | ||
+ | |||
+ | https://mega.hackteria.org/index.php/s/RABoDCFNsgxyiL3 | ||
+ | |||
+ | |||
+ | Bioart Critic - CGCB BioInfo Database Entry Form | ||
+ | |||
+ | https://mega.hackteria.org/index.php/apps/forms/zTSfk9WEigJQ9bab | ||
+ | |||
+ | Bioart Critic - CGCB BioInfo Multimedia Database: | ||
+ | |||
+ | https://mega.hackteria.org/index.php/s/NwEeFcFczwsdjjn | ||
+ | |||
+ | Click here to go Back to the CGCD gene List: | ||
+ | [[CGCBopen]] | ||
Study the below art and science multimedia database entries to inform your entry. | Study the below art and science multimedia database entries to inform your entry. | ||
Line 12: | Line 45: | ||
More information on D.nft from our public and open source art and science bioinformatics database: Study the art and science multimedia database entry below to inform your commentary. | More information on D.nft from our public and open source art and science bioinformatics database: Study the art and science multimedia database entry below to inform your commentary. | ||
− | |||
− | |||
− | |||
− | |||
+ | '''D.nft GOSPHA Basic Information | ||
+ | ''' | ||
Name of Creative Germline Transgenic Human Genome Alternatives Construct: | Name of Creative Germline Transgenic Human Genome Alternatives Construct: | ||
D.nft XMT-CYB, MT-CYBo | D.nft XMT-CYB, MT-CYBo |
Latest revision as of 11:48, 13 October 2021
D.nft also known as XMT-CYB, MT-CYBo
Synopsis: Under expression of D.nft disrupts female fertility, causes general debility and makes adverse effects on health. Mitochondrial Cytochrome B Stops inflation with free radicals. Over expression may be Anti artherosclerosis and explain effects on migrants stuck in Chinese and Bangladeshi Xinjiang Uyghur camps with their origin mutant MT-CYBo X. If Severe Obesity, give Benzo Barbs and remain clinically silent, you homoplasmic carriers! Mecha-spank.
Become a part of the CBCD D.nft entry by writing 100 or more words as: a bioart critic a bioart ethicist a bioart science fiction writer
Study the below art and science multimedia database entry to inform your commentary.
Please add to the D.nft entry by becoming a bioart critic, bioart ethicist or bioart science fiction writer by clicking one of the three links below:
Bioart Ethics - CGCB BioInfo Database Entry Form
https://mega.hackteria.org/index.php/apps/forms/bPTRLa5NAosYRd9K
Bioart Ethics - CGCB BioInfo Multimedia Database:
https://mega.hackteria.org/index.php/s/eEZSk63criQK7fd
Bioart Science Fiction - CGCB BioInfo Database Entry Form
https://mega.hackteria.org/index.php/apps/forms/goPy4ELMcGmFFbPw
Bioart Science Fiction - CGCB BioInfo Multimedia Database:
https://mega.hackteria.org/index.php/s/RABoDCFNsgxyiL3
Bioart Critic - CGCB BioInfo Database Entry Form
https://mega.hackteria.org/index.php/apps/forms/zTSfk9WEigJQ9bab
Bioart Critic - CGCB BioInfo Multimedia Database:
https://mega.hackteria.org/index.php/s/NwEeFcFczwsdjjn
Click here to go Back to the CGCD gene List: CGCBopen
Study the below art and science multimedia database entries to inform your entry.
More information on D.nft from our public and open source art and science bioinformatics database: Study the art and science multimedia database entry below to inform your commentary.
D.nft GOSPHA Basic Information
Name of Creative Germline Transgenic Human Genome Alternatives Construct:
D.nft XMT-CYB, MT-CYBo
Team Names: Ionian Pharma, HioHubGitGutter
Name of Gene of Study: cytochrome b
How do you usually express yourself: Other
What Organism(s) is the Gene Found In? : conical sea squirt (Lat. Aplidium conicum), human
Where in the Organism(s) is the Gene Expressed? : Mitochondria
What Does the Gene Do? What is the Action or Effect of the Gene? Mutation can cause health issues in sheep and effects female reproduction of Ghungroo pig. Mutation in Cytochrome B gene generally causes debility and adverse effects on health of sheep. Mutations in cytochrome B gene effects female reproduction of Ghungroo pigs.
Scientist involved in cytochrome b research: Aruna Pal, West Bengal University of Animal and Fishery Sciences, 37, K.B. Sarani, Kolkata 37, India.
Method(s) of Transgenesis,:
recombinant viruses (sometimes called biological nanoparticles or viral vectors), for instance: adeno-associated viruses (AAVs) (relative of herpes), oncoretroviral, lentiviral retroviruses (i.e. human immunodeficiency virus (HIV), which causes AIDS), adenoviruses, herpes simplex, vaccinia (pox), and human foamy virus.; microinjection; Photoporation (laser); aerosol/colonic: on or in mucosal surfaces, such as up the nasal and inhaled into lung mucosa or enema/pneumatic (jet) injection
Safe Harbor Landing Pads:
human SHS AAVS1; "Safe" Mongr X: address on the X chromosome in Base Pairs (bp) chrX: 79,674,328–79,674,347 Sequence AAAATGTCATAAGgCAGTTT 3 out of 8 on the 'safe' harbor scale, site ID 321 from Table 2. Location and scoring of canonical and newly identified potential human safe harbor sites, New Human Chromosomal Sites with ‘‘Safe Harbor’’ Potential for Targeted Transgene Insertion, Hum Gene Ther . 2019 Jul;30(7):814-828. doi: 10.1089/hum.2018.169. Epub 2019 Mar 28.
Inducible Promoters:
Light Shock, Optogenetically Refined Wavelengths TBA; Synth Cassette-optimized gene control with new inducer(s) of choice, i.e. the sound of frogs or popular condiments like mustard or sriracha mayonnaise, preventing off-target expression and reducing potential side effects of the treatment.; UBC Human ubiquitin C promoter, Ubiquitous in many ways.
Reporter Genes:
Resistance to persuasion, If you’re expressing a gene that may be toxic, it’s important that your inducible promoter not be too leaky. Trangenic humans with resistance to persuasion are known for their low leakiness. ; Gene Ween, tunable expression levels; Brainbow-2: random expression of different XFP ratios and subsequently causing different cells to exhibit a variety of colorful hues.; tattletale (TTLTL) DNA that codes for reporter protein molecules; specific membrane somatostatin receptors (hSSTrs) + DMT
GOSPHA Sequence:
Homo sapiens mitochondrion, complete genome NCBI Reference Sequence: NC_012920.1 GenBank Graphics >NC_012920.1:14747-15887 Homo sapiens mitochondrion, complete genome ATGACCCCAATACGCAAAACTAACCCCCTAATAAAATTAATTAACCACTCATTCATCGACCTCCCCACCC CATCCAACATCTCCGCATGATGAAACTTCGGCTCACTCCTTGGCGCCTGCCTGATCCTCCAAATCACCAC AGGACTATTCCTAGCCATGCACTACTCACCAGACGCCTCAACCGCCTTTTCATCAATCGCCCACATCACT CGAGACGTAAATTATGGCTGAATCATCCGCTACCTTCACGCCAATGGCGCCTCAATATTCTTTATCTGCC TCTTCCTACACATCGGGCGAGGCCTATATTACGGATCATTTCTCTACTCAGAAACCTGAAACATCGGCAT TATCCTCCTGCTTGCAACTATAGCAACAGCCTTCATAGGCTATGTCCTCCCGTGAGGCCAAATATCATTC TGAGGGGCCACAGTAATTACAAACTTACTATCCGCCATCCCATACATTGGGACAGACCTAGTTCAATGAA TCTGAGGAGGCTACTCAGTAGACAGTCCCACCCTCACACGATTCTTTACCTTTCACTTCATCTTGCCCTT CATTATTGCAGCCCTAGCAACACTCCACCTCCTATTCTTGCACGAAACGGGATCAAACAACCCCCTAGGA ATCACCTCCCATTCCGATAAAATCACCTTCCACCCTTACTACACAATCAAAGACGCCCTCGGCTTACTTC TCTTCCTTCTCTCCTTAATGACATTAACACTATTCTCACCAGACCTCCTAGGCGACCCAGACAATTATAC CCTAGCCAACCCCTTAAACACCCCTCCCCACATCAAGCCCGAATGATATTTCCTATTCGCCTACACAATT CTCCGATCCGTCCCTAACAAACTAGGAGGCGTCCTTGCCCTATTACTATCCATCCTCATCCTAGCAATAA TCCCCATCCTCCATATATCCAAACAACAAAGCATAATATTTCGCCCACTAAGCCAATCACTTTATTGACT CCTAGCCGCAGACCTCCTCATTCTAACCTGAATCGGAGGACAACCAGTAAGCTACCCTTTTACCATCATT GGACAAGTAGCATCCGTACTATACTTCACAACAATCCTAATCCTAATACCAACTATCTCCCTAATTGAAA ACAAAATACTCAAATGGGCCT