Difference between revisions of "Engoz"
(3 intermediate revisions by the same user not shown) | |||
Line 3: | Line 3: | ||
This gene encodes a member of the hook family of coiled-coil proteins. The encoded protein localizes to discrete, punctuated subcellular structures, and interacts with several members of the Rab GTPase family involved in endocytosis (when a cell brings in food or other materials to be internalized, the cell surrounds the other stuff with cell membrane, and then ‘swallows’ or sort of coats the food with breading made of membrane wall that buds off inside the cell to form a vesicle containing the ingested material. Its like your skin plastic wrapping every bite with skin that surrounds but then breaks away and goes with the ball that you bit… like spit is its own saran wrap protection or how we swallow into another outside as your digestive tract is not inside but actually we are donut shaped outsides. | This gene encodes a member of the hook family of coiled-coil proteins. The encoded protein localizes to discrete, punctuated subcellular structures, and interacts with several members of the Rab GTPase family involved in endocytosis (when a cell brings in food or other materials to be internalized, the cell surrounds the other stuff with cell membrane, and then ‘swallows’ or sort of coats the food with breading made of membrane wall that buds off inside the cell to form a vesicle containing the ingested material. Its like your skin plastic wrapping every bite with skin that surrounds but then breaks away and goes with the ball that you bit… like spit is its own saran wrap protection or how we swallow into another outside as your digestive tract is not inside but actually we are donut shaped outsides. | ||
engoz loss of function is linked with Adenomia or benign skin tags of glandular origin. producing large amounts of hormones in an unregulated, non-feedback-dependent manner. Can run ragged on your hormonal imbalance causing paraneoplastic syndromes (see movie The Brood). Can cause abnormal headshape in both live young and abnormal head shape in sperm. Microtubule retraction ... deforms heads and deforms sperm heads but microtubules also grab and retract chromosomes with mean, biting centromeres so this might eat strangely at the chromosomes during reproduction or cell division. Overexpression effect unknown... gland shield? Endocytosis Enhancer? | engoz loss of function is linked with Adenomia or benign skin tags of glandular origin. producing large amounts of hormones in an unregulated, non-feedback-dependent manner. Can run ragged on your hormonal imbalance causing paraneoplastic syndromes (see movie The Brood). Can cause abnormal headshape in both live young and abnormal head shape in sperm. Microtubule retraction ... deforms heads and deforms sperm heads but microtubules also grab and retract chromosomes with mean, biting centromeres so this might eat strangely at the chromosomes during reproduction or cell division. Overexpression effect unknown... gland shield? Endocytosis Enhancer? | ||
+ | |||
+ | Become a part of the CBCD engoz entry by writing 100 or more words as: | ||
+ | a bioart critic | ||
+ | a bioart ethicist | ||
+ | a bioart science fiction writer | ||
+ | |||
+ | Study the below art and science multimedia database entry to inform your commentary. | ||
Please add to the engoz entry by becoming a bioart critic, bioart ethicist or bioart science fiction writer by clicking one of the three links below: | Please add to the engoz entry by becoming a bioart critic, bioart ethicist or bioart science fiction writer by clicking one of the three links below: | ||
+ | |||
+ | Bioart Ethics - CGCB BioInfo Database Entry Form | ||
+ | |||
+ | https://mega.hackteria.org/index.php/apps/forms/bPTRLa5NAosYRd9K | ||
+ | |||
+ | Bioart Ethics - CGCB BioInfo Multimedia Database: | ||
+ | |||
+ | https://mega.hackteria.org/index.php/s/eEZSk63criQK7fd | ||
+ | |||
+ | |||
+ | Bioart Science Fiction - CGCB BioInfo Database Entry Form | ||
+ | |||
+ | https://mega.hackteria.org/index.php/apps/forms/goPy4ELMcGmFFbPw | ||
+ | |||
+ | Bioart Science Fiction - CGCB BioInfo Multimedia Database: | ||
+ | |||
+ | https://mega.hackteria.org/index.php/s/E6JaYkfGfjarQ32 | ||
+ | |||
+ | |||
+ | Bioart Critic - CGCB BioInfo Database Entry Form | ||
+ | |||
+ | https://mega.hackteria.org/index.php/apps/forms/zTSfk9WEigJQ9bab | ||
+ | |||
+ | Bioart Critic - CGCB BioInfo Multimedia Database: | ||
+ | |||
+ | https://mega.hackteria.org/index.php/s/NwEeFcFczwsdjjn | ||
+ | |||
+ | Click here to go Back to the CGCD gene List: | ||
+ | [[CGCBopen]] | ||
+ | |||
More information on engoz from our public and open source art and science bioinformatics database: | More information on engoz from our public and open source art and science bioinformatics database: | ||
engoz GOSPHA Basic Information | engoz GOSPHA Basic Information | ||
− | |||
− | |||
− | |||
Name of Creative Germline Transgenic Human Genome Alternatives Construct: engoz (from Hook1), Engoz_ph1 Contig | Name of Creative Germline Transgenic Human Genome Alternatives Construct: engoz (from Hook1), Engoz_ph1 Contig | ||
Line 31: | Line 65: | ||
[[File:NumérisationEngozpsd.jpg|400px]] | [[File:NumérisationEngozpsd.jpg|400px]] | ||
+ | On this Soundcloud link, Kaspar Konig plays accordion as qualitative data after considering enGoz in the human germline: | ||
+ | |||
+ | https://soundcloud.com/andi-wallwhore/hook1-accordian-kaspar-konig | ||
+ | |||
+ | Method(s) of Transgenesis: | ||
+ | |||
+ | recombinant viruses (sometimes called biological nanoparticles or viral vectors), for instance: adeno-associated viruses (AAVs) (relative of herpes), oncoretroviral, lentiviral retroviruses (i.e. human immunodeficiency virus (HIV), which causes AIDS), adenoviruses, herpes simplex, vaccinia (pox), and human foamy virus. Sonoporation (sound waves), Photoporation (laser), aerosol/colonic: on or in mucosal surfaces, such as up the nasal and inhaled into lung mucosa or enema/pneumatic (jet) injection | ||
+ | |||
+ | Safe Harbor Landing Pads: | ||
+ | |||
+ | CCR5, human SHS AAVS1 | ||
+ | |||
+ | Inducible Promoters: | ||
+ | |||
+ | Secretogranin II driven tetracycline-controlled transactivator Inducible and Reversible Rev-erbα and Clock Gene Oscillation Expression of Circadian Rhythmic Misbehavior, Synth Cassette-optimized gene control with new inducer(s) of choice, i.e. the sound of frogs or popular condiments like mustard or sriracha mayonnaise, preventing off-target expression and reducing potential side effects of the treatment. | ||
+ | |||
+ | Reporter Genes: | ||
− | + | Internal Reporter or Marker Genes: RAPD and SSCP, also for for DNA barcoding and Marker-assisted selection, gene mapping, genetic disease analysis and diagnosis. and genetic screening, sudden eruption of exoskeletal chiton, tattletale (TTLTL) DNA that codes for reporter protein molecules. | |
− | + | GOSPHA Sequence: | |
>chromosome:GRCm39:4:95854877:95914250:1 | >chromosome:GRCm39:4:95854877:95914250:1 |
Latest revision as of 17:29, 4 October 2021
engoz (from Hook1), Engoz_ph1 Contig
This gene encodes a member of the hook family of coiled-coil proteins. The encoded protein localizes to discrete, punctuated subcellular structures, and interacts with several members of the Rab GTPase family involved in endocytosis (when a cell brings in food or other materials to be internalized, the cell surrounds the other stuff with cell membrane, and then ‘swallows’ or sort of coats the food with breading made of membrane wall that buds off inside the cell to form a vesicle containing the ingested material. Its like your skin plastic wrapping every bite with skin that surrounds but then breaks away and goes with the ball that you bit… like spit is its own saran wrap protection or how we swallow into another outside as your digestive tract is not inside but actually we are donut shaped outsides. engoz loss of function is linked with Adenomia or benign skin tags of glandular origin. producing large amounts of hormones in an unregulated, non-feedback-dependent manner. Can run ragged on your hormonal imbalance causing paraneoplastic syndromes (see movie The Brood). Can cause abnormal headshape in both live young and abnormal head shape in sperm. Microtubule retraction ... deforms heads and deforms sperm heads but microtubules also grab and retract chromosomes with mean, biting centromeres so this might eat strangely at the chromosomes during reproduction or cell division. Overexpression effect unknown... gland shield? Endocytosis Enhancer?
Become a part of the CBCD engoz entry by writing 100 or more words as: a bioart critic a bioart ethicist a bioart science fiction writer
Study the below art and science multimedia database entry to inform your commentary.
Please add to the engoz entry by becoming a bioart critic, bioart ethicist or bioart science fiction writer by clicking one of the three links below:
Bioart Ethics - CGCB BioInfo Database Entry Form
https://mega.hackteria.org/index.php/apps/forms/bPTRLa5NAosYRd9K
Bioart Ethics - CGCB BioInfo Multimedia Database:
https://mega.hackteria.org/index.php/s/eEZSk63criQK7fd
Bioart Science Fiction - CGCB BioInfo Database Entry Form
https://mega.hackteria.org/index.php/apps/forms/goPy4ELMcGmFFbPw
Bioart Science Fiction - CGCB BioInfo Multimedia Database:
https://mega.hackteria.org/index.php/s/E6JaYkfGfjarQ32
Bioart Critic - CGCB BioInfo Database Entry Form
https://mega.hackteria.org/index.php/apps/forms/zTSfk9WEigJQ9bab
Bioart Critic - CGCB BioInfo Multimedia Database:
https://mega.hackteria.org/index.php/s/NwEeFcFczwsdjjn
Click here to go Back to the CGCD gene List: CGCBopen
More information on engoz from our public and open source art and science bioinformatics database:
engoz GOSPHA Basic Information
Name of Creative Germline Transgenic Human Genome Alternatives Construct: engoz (from Hook1), Engoz_ph1 Contig
Team Names: providere, iBlastoidz
Name of Gene of Study: Hook1
How do you usually express yourself: Eco Art or Gardening
What Organism(s) is the Gene Found In? : Mouse (Murinae)
Where in the Organism(s) is the Gene Expressed? : Water-Cell in parathyroid gland ; sperm headshape
What Does the Gene Do? What is the Action or Effect of the Gene? : This gene encodes a member of the hook family of coiled-coil proteins. The encoded protein localizes to discrete punctuate subcellular structures, and interacts with several members of the Rab GTPase family involved in endocytosis. Defects linked with Adenomia or abnormal headshape.
On this Soundcloud link, Kaspar Konig plays accordion as qualitative data after considering enGoz in the human germline:
https://soundcloud.com/andi-wallwhore/hook1-accordian-kaspar-konig
Method(s) of Transgenesis:
recombinant viruses (sometimes called biological nanoparticles or viral vectors), for instance: adeno-associated viruses (AAVs) (relative of herpes), oncoretroviral, lentiviral retroviruses (i.e. human immunodeficiency virus (HIV), which causes AIDS), adenoviruses, herpes simplex, vaccinia (pox), and human foamy virus. Sonoporation (sound waves), Photoporation (laser), aerosol/colonic: on or in mucosal surfaces, such as up the nasal and inhaled into lung mucosa or enema/pneumatic (jet) injection
Safe Harbor Landing Pads:
CCR5, human SHS AAVS1
Inducible Promoters:
Secretogranin II driven tetracycline-controlled transactivator Inducible and Reversible Rev-erbα and Clock Gene Oscillation Expression of Circadian Rhythmic Misbehavior, Synth Cassette-optimized gene control with new inducer(s) of choice, i.e. the sound of frogs or popular condiments like mustard or sriracha mayonnaise, preventing off-target expression and reducing potential side effects of the treatment.
Reporter Genes:
Internal Reporter or Marker Genes: RAPD and SSCP, also for for DNA barcoding and Marker-assisted selection, gene mapping, genetic disease analysis and diagnosis. and genetic screening, sudden eruption of exoskeletal chiton, tattletale (TTLTL) DNA that codes for reporter protein molecules.
GOSPHA Sequence:
>chromosome:GRCm39:4:95854877:95914250:1 File:Mus_musculus_Hook1_full_sequence.pdf
TGGACACATCATTATTATTATTTTTTAACATAGAAACGAGCAGGTAGGGTACACAGATAC AGCCTATGCTTTTTGAACACTATTTAATTTTGCTATCTAAAAACGGCCTTCCCCTTTGCC CCATTTAAAATGAAATCAGCCACAACCTGTGATTCTGTGAGGGCTTCTTTGACTTAGGCA GCATGGAGGTCTGTTTTTTCCTTAGGAAACACGTTTCTTGGTCACGTGGTTCCTCTTGCT TTGGGGGTTTCAATTCCTGAGCACTGTGGTGGGGAATGAGAAGAGGCTGGAGGCTGAGAG TGGGTCTGTACTAGTGCTAACCAGGAGAAATGGAAGGTTGGCCTCTGAGCCCTCCACTAC CTTTGGCCACTCTAGCTCGCGCAGGCGCGCTCTCCTTCCTACCCCCAGCCCCGCCCTCAT TGCACCTGCCAGGTCATAAACCTCCGCCCACCCACACCCGCTTCGCCTGGCGGTCCGGGC TTACCCCTCCTTGATTGGCCAAGAGTCTCTGGAGCGCGTCCAATCAGCAGCCCTCCTGTG CGACCTATTCCCGCTCCTCCCGCCCTGCCGGCCTCGCTGGTGCCCAGCTTCTTTGTGACT GGTGCTCGCAGAGGTCACTCAGCGTGCGGTGTGCGATCGGCGGGCGGGGCCGGCTCAGGT GCCGGGACGCGGGACAGACGCGGTGGGCGAGGGGGCGGTCGCGCCGCGACGTCTGCGCCG TGAGGCTTCGCGCGTGAGTGGCGCGGGCGCCAGGCCTGGCCGCCGAGCTCCAGTGGCGGG CGCGGAGGTCGTTGACGCGGGCCCGGTCGGAGGCGCGTCCGTCGCTGTGAGCGCGGCGTC GAGGTTCTCGGACCATGGAGGACCCGCAGCCGCTGCCACAGTCCGAGCTGCCGCTGTGTG ACAGCCTCATCATCTGGGTGAGTGTAGTTCCACGCTTGCCAGCGAGGCCACCTGCGGGGC GAGCGGAGCACGGAGCCTCCGGCTGCCACGTACACCTCCTCCGCAACCCTTCCGTCCCAG CCTCTGAGAGCTCCGCCTCGCACAGGTGACCAGGAGGCGCTGGCAGCCTCGGTTCCCAGA TTGCTGTCCTTTTGGGCCCACACAGCACCCATGGCGGTGTAGACACAGCTGAGAGAGATG GCCAAATTACCTTTGATGTGGGAGCTCTTTTTCATTTTTTCCCCCTCTTCCTCCCCTTCC CATCTTAATACCTTTCTTTTTTTAAAGTAAAAAAGAATTGGCTTTTTTTGTTTACGCTTG ATCCATGTGCAGGATTTTTTTAGCGCAGATTGCCTCAGTCCTCATTTTTTCCCAGTATTC CGGTGAGCCAAATGGTTTCTAACCTGTTGGAATTTCCTAGATATGACAGAACTGCCGTCC AGGTGTGATTTCTAGGCCTTTATTGTGCTAGGATAGTGTTTGATGCCCTACAGTTGGGTG TTGATAGCGCTGATGGCTCAACTCAGTTGTATAATTGTGAAGAGAGTCTGATTGGAATGT AAGTAGACTGGATCAGGAGGATTACATCCTCCAAGAGATTGACTGGCCATCTTCTAATAC TAGCAAATCCAAAGGACAAATAGGGAAGATCTCTATGAGTGTTTGAAATTTGTAGTCACT TTTGCACTTTAGACTTTGATAACATGTTTTAAGTAGAATGTAGTTAGGATCTCAGGGTTA AAGCGTTTAGCTCACTGTAGACCTGCATGTTTATTTAAATTACTATTTAGGTTTAGATAT TGTATTTAAGATTGTTAGGAAAGAAGGCAGTATTACTTTAATGATCCCATTTGTTTAAAA ACAAATGTCTAATCATAGGGTGTATTCAGGTCTGCAATTTTGTGCTCTGATCATCTGACT GAGATGGTAAACTGGGTTCTTTATGATGTCACTGACTTCCCTATGAGGTCACATGGAGTT CAAGAGTTTCTTAAACTATACTGCAATATTTCCAAGTGCTATGACCATATCCTTTCTTAA AGCAGTATTTTGACTTCCTACTTTGTGCTGGCCTCACAGGAATTAGTTTAACTAGCAGAG TTGTGTATCATTACAATGAAAGGCAAAGTTCCCCAAGATCTAGAGAGAGAGAGAGAAAGA GAGAGAGAGAAACAGAGAGAGAGAGGGAGAGACACACAGAGAGAGAGAGAATGAACCAGA TAAGGATTCATAGACAATAGAGGGTGAGAGGGTGGTTGGTTAGCTCTTGCTAATTGGCTC CTGCAGTGATCTCCCAGGCTGTTGTACACTGGAGAAAATTGAATGGCTGAAAATCAGTTA TTGCTTCTAATCATGGCGGTAGATGCACTGTTCTCCCTGACACTGTCCAGCTTGGTGATG GGGAAGGACATGGTGGTTCTGATTCTTTTTAGGACGCTTCATTGATGCCCTGCTTGGCTC TTCTTGGAACCGAATTTTGACTTTCAGGCACAATACCACCTCCTCAGCTTTGGGTCTTCC TTTAAACTCTGTTCCTTCTAACTCTTTTAGAGCATTGTTCTGCCATTTATTTTCTTTTTG CTGTTGAATCTGTCTAACCCTGACCCCCAACTAAACAAGGGATCTCTGCATGTGCTCTTC TGATGGAGCTGTGTCCTCAACCTCCTTTTTACTTAAGTCAAGACACAGTCTAAGATTTCC AGAAATCTTAGCCTGAATTCAATATGGCTGGTAGACGTGTGAGACTTCTTACACCTCCCA AGCGGCTGGGAGTACATTCTTGTGACAGCAGGCACTGCTGTTTACAGCGTGATTCAATTA GCCATTTCCTTCATATGCTTTCATTTAACCTTTTACTATTTTAAAAATAACTAAGGCACC ACTCTAGTTATTCCATGCTGTAATGCTTCCTCTTTCCCAGTAAAGTTACAACCCCCACAC CTTTATACTTTTTCCTTTCACTGCTCAGCCCATTATATTTTAATTCCTTTACTTTTAAAA AAAAATAAATTAGTTTATCTATTTACATTCCAAATGTTGCCCCTCTTCTTGGTTCCTCCT CCCAGAGTTCTTCACCTCATCGTCCTTCCCTTTGTTTTACAGAGGGTGCTCATCCCCACC CCTTCACCTTTCCATACCCCCCTTTGCATCCCCCCCAACCTTTCCACCCCCCCCAATCCC CAGCAACTCTCACCTCACCCACTCTCAAGAATCCCTCTTCCCTGGGGTATCTACTCTTTA CAGTAAGTTTAGCACAGCCTCACCCACTGAGGCCATATAAGGCAGTCCTCTGTTACATAT GTGCTGAGGGCCATAGACCAACCCTTGTATGCTCTTTGGTTGGTGGCTTGGTCTCTAGGA GCTCCAGGGGACCAGGGTAGTTGATCCTGGTGGTCTTCCTGTGGGGTTGCCATCCCCTTC AGCTCCTTCAATTCTTCCCCTAACTCTTCCATAGGAATTTCCAACTTTAGTCCAATGGTT GGCTGTAAGTATCTGCATCTGTCTCAGTCAGCTGCTGGTGAAGCCTCTCAGATGACAGCC ATGCTAGGCTCCTGTCTGCAAGCAGAACATGGCATCACTAATAGTGTCAGGGTTTGGTGC CTACTCCTGGGATGAATCTCAAGTTGCTCCAGTCACTGGGTAGCCTTTCCTTGAAACTTT GTTTCACTTTTGTCTCTGTATTTCCTTTAGATAGGATCAAAACTTTTAAAGATGGGTACA TCGCCCCATCCAGTCTCTGGGGTCCCTGTCTATGTACTGGAGGTGGTCTCTTCCAGTTCC ATCTCCCCACTGTTGGGTATTTCAGCTGAGGTTATCCCTATAATCACTGGAGGCAGAGGG AAGAAGGAACCTGAGTGGGAGGAGGAAGGGGATTGAAGCATCCTCATTTGGGCCTTCCTT TTTCTTAAACTTCCTATGGTTTTTGAGTTGTATTATGGGTATTCTGTACTTTTTGACTAA TAATCCACTTATTACTGAGTACATACCATGCATGTCATTTTTGGTCTGAGTCATCTAGCT