CGCB

From Hackteria Wiki
Revision as of 16:55, 10 June 2021 by Dusjagr (talk | contribs) (Safe Harbor)
Jump to: navigation, search

With the Mind thGAP release of the first fully knitted and reviewed GOSPHAs to the CGCB - Creative Germline Constructs Bank we are starting a new wiki page to aggregate them all!

Short description of generic GOSPHA

GOSPHA GRAPHIC. NNGL.jpg

Needs some description @neoangel

NNGL GOSPHA DNA.jpg

CGCB_00001: SuRaS - super repair after sunburn

Author(s)

octopus teacher

Gene Action

Repairs DNA - excision repair to get rid of bulky lesions and thymine dimers Here is a link about all the different repair pathways in humans... https://www.wikipathways.org/index.php/Pathway:WP4946 https://pubchem.ncbi.nlm.nih.gov/pathway/Reactome:R-HSA-5696398

Your Genetic Sequence for the Creative Germline Constructs Bank (CGCB) of the Transgenic Human Genome Alternatives Project (thGAP_)

>XM_017019769.1 PREDICTED: Homo sapiens RAD52 homolog, DNA repair protein (RAD52), transcript variant X1, mRNA

https://www.ncbi.nlm.nih.gov/gene/5893

GAGACACCTAGCCCCGCCCCCAGCCCCGCCGCGGGGCGCAGCGCGCCTCCCCGGGCTCCCGGCTCGGCTGCCTCCCTTTCCCTCAGCCTCCCGGGAGCGTGACGCGGCGGCCCGGGGGCCTCCGGGCGCCTTCCGGGGCACGCGGGATCGACATGCACTTGGATCATTGCAGTTTCTGGGCCTGCTGTCATCTCCCCCTTCAGTACTTCCCACATATGACTACCAACTGTTAGACGATGTGCTGCTGCCAGACCAGCCTTTCATTTCTTGGACATCCGGCTATTTACCCAGGAAAAGTCATCCTTTGACTATTTTTCATGACCTTTCTCATCTGACTCGTGATCTGCCCATCTTGTTACTCCCTAGCAGTGTGGTAAGAGGTCAACCAGAATCAAGATGTCTGGGACTGAGGAAGCAATTCTTGGAGGACGTGACAGCCATCCTGCTGCTGGCGGCGGCTCAGTGTTATGCTTTGGACAGTGCCAGTACACAGCAGAAGAGTACCAGGCCATCCAGAAGGCCCTGAGGCAGAGGCTGGGCCCAGAATACATAAGTAGCCGCATGGCTGGCGGAGGCCAGAAGGTGTGCTACATTGAGGGTCATCGGGTAATTAATCTGGCCAATGAGATGTTTGGTTACAATGGCTGGGCACACTCCATCACGCAGCAGAATGTGGATTTTGTTGACCTCAACAATGGCAAGTTCTACGTGGGAGTCTGTGCATTTGTGAGGGTCCAGCTGAAGGATGGTTCATATCATGAAGATGTTGGTTATGGTGTTAGTGAGGGCCTCAAGTCCAAGGCTTTATCTTTGGAGAAGGCAAGGAAGGAGGCGGTGACAGACGGGCTGAAGCGAGCCCTCAGGAGTTTTGGGAATGCACTTGGAAACTGTATTCTGGACAAAGACTACCTGAGATCACTAAATAAGCTTCCACGCCAGTTGCCTCTTGAAGTGGATTTAACTAAAGCGAAGAGACAAGATCTTGAACCGTCTGTGGAGGAGGCAAGATACAACAGCTGCCGACCGAACATGGCCCTGGGACACCCACAGCTGCAGCAGGTGACCTCCCCTTCCAGACCCAGCCATGCTGTGATACCGGCGGACCAGGACTGCAGCTCCCGAAGCCTGAGCTCATCCGCCGTGGAGAGCGAGGCCACGCACCAGCGGAAGCTCCGGCAGAAGCAGCTGCAGCAGCAGTTCCGGGAGCGGATGGAGAAGCAGCAGGTTCGAGTCTCCACGCCGTCAGCTGAGAAGAGTGAGGCAGCGCCTCCGGCCCCTCCTGTGACGCACAGCACTCCTGTAACTGTCTCAGAACCACTCCTGGAGAAAGACTTCCTTGCAGGAGTGACTCAAGAATTAATCAAGACTCTTGAAGACAACTCTGAAAAGTGGGCTGTGACTCCCGATGCAGGGGATGGTGTGGTCAAGCCCTCGTCTAGAGCAGACCCAGCCCAGACCTCTGACACATTAGCCTTGAACAACCAGATGGTGACCCAGAACAGGACTCCACACAGCGTTTGCCACCAGAAACCACAAGCAAAATCTGGATCTTGGGACCTCCAAACTTATAGCGCTGACCAACGCACAACAGGAAACTGGGAATCTCATAGGAAGAGCCAGGACATGAAGAAAAGGAAATATGATCCATCTTAACTGAGGCTCAGGCCACATAATTGGACTCTGTCACAAAGGGACTTTGGAAAACTACTTTTTGGTCATGAAATTGTTCATCGCTGCTGGAGAATGAACGTCATTGCGATTTATCTTGCTTCATTCTGAACCTTATCAAGAGGATCTGACTGAGAGCCCACTGCAGTTAGAGCTGAGCACTTTTGAAAAGCTTGTCCATCACTCTAGTAGGGAGAGGCTCTGGACAGATGAATACCTTTTCTTCGGCTTGTGAGGCTTCCCACTATTTATTACTGAACTATTATGTAATGAAGATGGACATTTTAGGAATCACCAATGGCTCCTTGCCCTCAAGCAATATAGGCCAGACTTGGTCCTAAGCACCTGCCTCAGCAATTGTCTACATTCAGTTGTTTTGCATAACGTCTGCCTTCTTTCCTTTACGGTCCATGCCTTTAATGTTGCCCACATTAAGCACTGTGGATCACGACAGGAAAAAGGTTGGAGCAGTGCTTTTCACTACTTTGTATCAATCCAGGCTACAATCTTCATTTAATATAAATAATTTATGGATTTATGACATTACAATCCTGCATTGTTTCAAGACTGACATTTTTTCCTAAGGAAGGAAATAATCATCTAAGACCACGAAAAAAGGCTGTTTTTTGTTTTTTTTTTTTTTTTTTTTTTTGAGACGGGGTCTGGCTGTGTTGCCCTGACTGGAGTTCAGTGGTGCAAACACAGCTCTCTCCACAACCTCTTGGGCCCAAGTGATACTCCCACCTCTGCCTTACAAAATACAGGGATTACTGGTGTGAGCCACTGTGTCTGGCCAGAAAAGGCATTTTTGAGAAAGCAAATCGTATACCTTATTAACAAAATAGAATATATATATATTGCTTATCTGAAATGCTTGAAACCAGAATTGTTTTGCATTTTTTGAATATTTGTATACACATAATGAGACCTTGGGGATGGGACCCAAGTCTGAACGTGGAATTCACCTGTGTTTCGTGTATATGCCTCATACACATAATTTTGTGCATGAAACAGAGTTTTTGTATAAGAAGATACACTGCAGCTGAAGAGGGCTGGGTTTTTTTTTCTCTTAGGGTCGCTGCATAAACTGTTGTATGCCTGGTGCTTTGCGACTTGTCACACGAGGTCACGTGTGGAATTTTCCACTTCTGGCATCACGTCAGTGCTCAGAAATTTTCTGATCTCAGAGCATTTCAATTAGGGATGCTCAAACGCAACTGTTTCTACTTCCCCATTTCAGGTGTGAGATGTAACCCACCTTGACCATAAATTGGCTTTTCATAGTGCTCAGATGTTTCATAATTCTTCCCCCAAAATAATGAAGTTTGCAGTTTAACAACTTTTTTTTTGAGAGGGGGGGTCTGGCTCTGTAGCGCAGGCTGGAGTGCAGCGGTGCCATCTTGACTCATTGCAGCCTCCGCCTGCCAGGATTCAAGCAATTCTCCTGCCTCAGGCTCCCGAGTAGCTGGGATTACAGACACCCACCACGACGCCCGACTAATTTTTGTATTTTTAGTAGAGGAGACGGGGTTTCTCCATGTTGGCCAGGCTGGTCTCAAACTGACCTCAAGTGATCTGCCCACCTCGGCCTCCCAAAGTAAAAAGTACTAGAATTATAGGCATGAGCCATTGCGCCCAGCCAATTTAATAATTTTTTTAGACGTATTATTTTGGGCTGGGCTGTGGCTAATCTTGAAGCAGTGACTTCCTATTTTTTGGCTCAGACCCATTTGGGAAGCTGTGAACCTGAGATAAGGAAGTCTGAAAGTACTAGCCGGCAGCCGACCGTTTCTATTCCTTTCGAAGTTAAGGAGACAGCAAAGGAGCTCCCAGGAATTAGGGATCCAGTTATAAATTGCACTTAACTCAAAATAGTGCCAGTGAGAATGTGAAGGAATCTTCTGGAAATGAAACCCCACAGCTCAACAAAAGCAAGTTTGGTTTATTTGAATGGTTTCATTAAATAAGTCTACAAAGGTAACAAACTGAAGCACAAAGCGCAATCTTACAAGAAGCGCAACACCCAGAGTTAGTGCAAAATGTACAATTAACGGCTGCTGAGAAACCCCCAAAGTTTGAATTTTTATTTTTATTTTTAACAGTGTACATTGTTAAA

Method(s) of Transgenesis

  • lipofection, including The Center for Alternative Coconut Research's 'Open Source and Topical' Lipofection Massage Cream or Liposomes (cationic) microspheres like they have in those RNA injectable vaccines

Safe Harbor

Inducible Promoter

No inducible promoter this GOSPHA, thank you.

Reporter Genes

Resistance to persuasion, If you’re expressing a gene that may be toxic, it’s important that your inducible promoter not be too leaky. Trangenic humans with resistance to persuasion are known for their low leakiness.

Bioart Critic

Face it, the whole idea of super repair is actually full of issues! if repair can't occur with mistakes, for instance, we might lose immune system function (and who knows what else, as the immune system recombinase is also active in the BRAIN!!) in our putative 'superrepair' transgenic being!

Bioart Ethicist Review

poor little transgenic being... obviously orthogonal. chameleon and taxonomy issues are evident. what kind of story could it have to tell, if it can only do pure homologous recombination, no matter what? an archipelago of nonsense ready to be viewed... better not to see it at all…


CGCB_00002: Stinky (SnK2) WetNap (Wnp3k) aka bleuCheeze

Ready for review

Author(s)

Blue Cheese Mutant Gene Neuro Extension Omnipotence Factory Fun Team 2b (NEO-FFUN2b)

Gene Action

Your Genetic Sequence for the Creative Germline Constructs Bank (CGCB) of the Transgenic Human Genome Alternatives Project (thGAP_)

Drosophila melanogaster chromosome 2L NCBI Reference Sequence: NT_033779.5 GenBank Graphics >NT_033779.5:5907169-5922776 Drosophila melanogaster chromosome 2L

GCTGGAGAAAATTTGGTTCATATTTTCATACGTGAAACAAGATGTAAAACGAGTGCATTTAGGGCCCAAAATAGTGAAAACTCACACGGGAAACACAATGCTAGCGACGGATAGCAAAAGTAAGTGACGGCTGCACGAAATAAGCCGGAAAAGTGCATGTGAAAATTTTCAAATTCGACCTATCTGCTGGTTTGTTCAAGGGTGGGTGGCGGGCAGAGAGGCCGAGTGAGAGTACGCGAGAGAGGAAGAAAAATCAATAAAATTGTCGTGAGGCGCGATTGACTGGAGCAAAACAAAGTGCGACACGAAAGAGAGCGCTAAGCGGACTACGAAAAAGCAACAACAGAGCGGCCGTTAGCTGAACCAAATGCGTTGGCAGAAAAGAGAGGTCAGATAGTCGGTAGTTTCAAAGGGAGTTGGAGTAAACAAACAAGTGCGCAATAAGTAAACCAAGAACAGCTGTCTCGCACAAAATGTAAATATTTCCCGAATATATGGAATAATAACCACTATCGGTTAATCGCTTGCTCGCTATGTAGGCGTACGAATCGAATCGAGTCGGCGACAGAGGCAACGTTCATTCACTCGCGAAAAGTTAATACTCGCACCGAATACAATGATCGCACTTTTCGTGTGATTCACCTCCAGCGGCCGCTAATTAAGGCGGCGGCAGCAGAAATAGAATAGCTGCGAAAACAAGCCATAACGCCAACTGCACTGTGCGCGGTTGTGATTTGGAAGCCACTCAATTGAAAGTGTCAGTGCTGTGCAAATAAATCGCCAAAATATCTCACCTCCAATGTTCAAAAGATACAATATCTACAATAAGCACAGGTTCTATGGAAACATATGTTTAAATGCGAAGCGACACGTTTTGAACTGAAACCTGCATGAAAGTGGGAAAGTTCATTAAACTACAGCAGTAAAAAGTTTCAAAATACTATGAAATATCTTTTTACACCTTTATCGAATAATATATAATCTTTTTAAACGGCATAACATTGTAAACAAGTGAATCACCATTATTAAAACACATGTAGAAAGTGCCACCCCCTTGCAAAAAAATCAATGACATTCCTCATAGTACAGCCATTAGATTAGTCTTATATTTTGTATTAAGTCAACTTAATTTTCTCTCTTTTAGATTAATCTTACCGCAAATCAACAAACACAAAGATGAATGTAATGCGTAAGCTGCGCGGAGCGGCCAGCGCAGGCAGCGTCAGCGGCAGCAGTAGCGGAACCTCGACGGCGAACAACAGTTCACCAGGGAGCAGCAGAACGGATGCTGGTGCACCGACCGCTGCAAATGGACGGAATGCGGAGGAGGCGCTGATGGACGCCCGCGTCCAAGTGAGCCTCACCACGCTAAAGAAGCTATTCAACGAATACACTCATCCGCGGGAGCCGCTGAGCGAACAGGAGCGCGATGACAAGCTCTACGAGATGCTGCCCCTCTTCTGCAAAGTGAGTGAATCAGTCGGTATGGAGGAATAGGCCACTAACTCCCCATTCTTACAGGTCTTCAGCAGCTGTCCGTCAAACGACATGAGCGAAAAGTTCTGGGACGTGGTCGCCTTCTGCCAGCAAGTGTCCCGTCTCATGGTCAGCGAAATCCGCAAGCGCGCCTCCAACCAGAGCACAGAGGCGGCATCCATTGCCATAGTCAAGTTTCTCGAGGTGGAAACCACCGAGGAAACCAGCAGCGGATGGATGCTTTTGGCTACCCTCAATTTGTTGGCCAATGGAGACGTATCTCTCATACAGGTATGTTTCATTTATAAACTGCTATAGTATCTTATGGTAAAAATACATCGACGTAATCAAAACAAAAAATTTCAATAGCTACAATTTTCGTTAGGGAAAGTCGTCATCAAATTCACGAAGTTTTCTCAGTTCCAGGCTTCAAAGAGAATTCGATGTGTGAGTTCGTAGCTTCTTCATTTGTAATATTTGGGTTGGCTGCATCTGGAACTTGTTGTTCCTTTTCTCCCGCATCGCTTGGCTTATGGACCAATTCAGCATTGCTTAAAGTTCTGAGCCGAGAATAGCTAGAGCCCTGTTCTACCAGCAAAATCTCCGATTTCTCCCTTTTCTCAGTGTCCGCCCACATGGAAGATCGCCGGGCTAGCTTCCGATCCATTTGAATGGGTTTCATTGTGGCCTCGCTGTTCTCACTTGACCGAGTTGAAACAAGGCTAACAGTGCTCCTGTCCTCGATTTTGGCCCACAAGCTCGAGGAATCGCTGGAGCCGCGCCAGGCTGAAGCAGACCTGCGCATCTTATTGGCCTGCTCTTCCATGTACACACTGTACTCCGTGTCCACCGGTGTGATATCCGATTCACTGGTGGTTATTGTTGGCGTTGATAGAAAACTCTCGTCACTCTCGATCTGATGCAGCGAAAAGAACTTTTTACGCGCATCCCCAATGAACTGCCACATGCGGACTATAAAGTGCGGCTGCTCCACCTCCGCGTTCGGCCGGAAGTACAGGATCTGAGAATTGGCCAACTTATAGTAGCACCTGCAGCATTTGCATAGAAAGTCGTCCACTGGCTTGGAAAGCACAAATAGCCCGGTTGAACCAGACTCTGTTCCCTCAAAGTACTTACGGCCAGTCGCCTGACGTTTCCAGTCGCCGGGTTCCATGCGCATCAGCAGGTCGAACACGTGGAACATGTGCATCAGGTACATGGTGCCAGTAACCAGCGCAGCGATGCTCTGCTGCTTGCAGTGCGCAAAGTGCGGATGTTCCAGATACTCGATGGTAGAATTGATGAAGGCCAGGTGAGGGTCCAGCATGGCGGTGCGCATTATCAGCACGCCGCAGAAATAGTGCGACAGCACGGCACTCAGTGTGAGCAGGAGCTGGGAGGAGAGCACCGTACTCCTAGCCAATAGCAGTCGGAACGCGCCTAGAGCGGCGAGCGCCGTAAAGGACGAAAATGTGGCACAATATAGGATCACATGAGGAGTACGCTCTGGCCAGTAGGATGAGCCGCGTATGTGGAAAAACATACAAACACTGCCCAGCAACACCTCGATGAGTTTAAAAAACACCCAAACCTGGTTCATTTCACAGACGTATTCTAGTTTAAAATGGTTTAGATTTAGTTTTGGCAACAGATGAAAAAGGTTCTGCGGGAAAAGTTGTATCTCAAAATACAAAACACCGCCGGGGCTGCGGGCTTAAATTAAGATGTTAAATCTAAACTAACTAAGCAATTCTAATATTGCTGCATTTCAGGTCATGACTGCTGCGGCGGTTCCCTCTACTTTAGTGAAGTGCTTGTACTTGTTCTTCGACCTGCCCATAGTTGAGGACGATGAGCCTTCAGCTGACGGTGGAGCAGTAAGTGAGTTTAATGCCCATGAAAGGCGGACGCTTCTGCAGAAGGTGTTTGTGCAGCTGCTGGTCAAGCTGTGCTCGTATCCGTATCCCGCTGAGGAACTAGCTCGCATGGACGACTTGACGCTGCTATTCTCGGCCATCACATCGCCATGTCCCATCCACAATATTGTATGGCGCAAGAACGCAGCTGAAATCCTGACCACAATATCAAGGAATGGCCTAACCGATGCCGTAGTTAGCTATATACATTGTAAGTATGGTGGACTTAATCATTATGACTAAATATTCTTAAAATGTTTCTTAATTTAGCCAAGGGCTGCATGGCACTTTGCGTGGACAATATGCAGCGCCTGACGTTTGGAAATCCTTTGGAGATCGTTGAAATGTTCGTCACCGTGTTCTGCTTTCTCAAGGACTCCAGTCAGGT 

full text in Sequence Blue Cheese.md in https://mega.hackteria.org/index.php/s/3agCCG5BKJLpFE5

https://mega.hackteria.org/index.php/s/bpwxjJqCzNCwcr6

Method(s) of Transgenesis

  • recombinant viruses (sometimes called biological nanoparticles or viral vectors), for instance: adeno-associated viruses (AAVs) (relative of herpes), oncoretroviral, lentiviral retroviruses (i.e. human immunodeficiency virus (HIV), which causes AIDS), adenoviruses, herpes simplex, vaccinia (pox), and human foamy virus.
  • biolistics
  • lipofection, including The Center for Alternative Coconut Research's 'Open Source and Topical' Lipofection Massage Cream or Liposomes (cationic) microspheres like they have in those RNA injectable vaccines
  • HAC, Human Artificial Chromosome also known as the MicroChromosome or #47
  • aerosol/colonic: on or in mucosal surfaces, such as up the nasal and inhaled into lung mucosa or enema/pneumatic (jet) injection

Safe Harbor(s)

  • HsROSA26;
  • subRosa, (sRs), the subRosa "safe" harbor name honors feminist pioneers in art, activism, labor, science, and politics: Rosa Bonheur, Rosa Luxemburg, Rosie the Riveter, Rosa Parks and Rosie Franklin.;
  • Kiy-gh Knock-in [your gene here] designed to Knock-out the gene for gullibility (GUL) during mutagenesis.

Inducible Promoter

Reporter Genes

Bioart Critic

Bioart Ethicist Review

CGCB_00003:

Ready for review

Author(s)

Gene Action

Your Genetic Sequence for the Creative Germline Constructs Bank (CGCB) of the Transgenic Human Genome Alternatives Project (thGAP_)

Method(s) of Transgenesis

Safe Harbor

Inducible Promoter

Reporter Genes

Bioart Critic

Bioart Ethicist Review