Difference between revisions of "CGCB"

From Hackteria Wiki
Jump to: navigation, search
(Method(s) of Transgenesis)
(CGCB_00003:)
 
Line 107: Line 107:
  
 
== [[CGCB_00003]]:  ==
 
== [[CGCB_00003]]:  ==
 +
to be knitted
 +
 +
=== Author(s) ===
 +
 +
 +
 +
=== Gene Action ===
 +
 +
 +
=== Your Genetic Sequence for the Creative Germline Constructs Bank (CGCB) of the Transgenic Human Genome Alternatives Project (thGAP_)===
 +
 +
=== Folder name of your [https://mega.hackteria.org/index.php/s/tWbmPQHAxkPWftG Data Dump for files on the CGCB] ===
 +
 +
=== Method(s) of Transgenesis ===
 +
*
 +
 +
=== Safe Harbor ===
 +
 +
 +
=== Inducible Promoter ===
 +
 +
=== Reporter Genes ===
 +
 +
=== Write draw or sketch what you think this gene will do to change human ===
 +
 +
=== Bioart Critic ===
 +
 +
 +
=== Bioart Ethicist Review ===
 +
 +
 +
== [[CGCB_00004]]:  ==
 
to be knitted
 
to be knitted
  

Latest revision as of 18:21, 10 June 2021

With the Mind thGAP release of the first fully knitted and reviewed GOSPHAs to the CGCB - Creative Germline Constructs Bank we are starting a new wiki page to aggregate them all!

Contents

Short description of generic GOSPHA

GOSPHA GRAPHIC. NNGL.jpg

Needs some description @neoangel

NNGL GOSPHA DNA.jpg

CGCB_00001: SuRaS - super repair after sunburn

Author(s)

  • octopus teacher
  • RA's SuperRepair
  • octopus teacher team 2

Gene Action

Repairs DNA - excision repair to get rid of bulky lesions and thymine dimers Here is a link about all the different repair pathways in humans... https://www.wikipathways.org/index.php/Pathway:WP4946 https://pubchem.ncbi.nlm.nih.gov/pathway/Reactome:R-HSA-5696398

Your Genetic Sequence for the Creative Germline Constructs Bank (CGCB) of the Transgenic Human Genome Alternatives Project (thGAP_)

>XM_017019769.1 PREDICTED: Homo sapiens RAD52 homolog, DNA repair protein (RAD52), transcript variant X1, mRNA

https://www.ncbi.nlm.nih.gov/gene/5893

GAGACACCTAGCCCCGCCCCCAGCCCCGCCGCGGGGCGCAGCGCGCCTCCCCGGGCTCCCGGCTCGGCTGCCTCCCTTTCCCTCAGCCTCCCGGGAGCGTGACGCGGCGGCCCGGGGGCCTCCGGGCGCCTTCCGGGGCACGCGGGATCGACATGCACTTGGATCATTGCAGTTTCTGGGCCTGCTGTCATCTCCCCCTTCAGTACTTCCCACATATGACTACCAACTGTTAGACGATGTGCTGCTGCCAGACCAGCCTTTCATTTCTTGGACATCCGGCTATTTACCCAGGAAAAGTCATCCTTTGACTATTTTTCATGACCTTTCTCATCTGACTCGTGATCTGCCCATCTTGTTACTCCCTAGCAGTGTGGTAAGAGGTCAACCAGAATCAAGATGTCTGGGACTGAGGAAGCAATTCTTGGAGGACGTGACAGCCATCCTGCTGCTGGCGGCGGCTCAGTGTTATGCTTTGGACAGTGCCAGTACACAGCAGAAGAGTACCAGGCCATCCAGAAGGCCCTGAGGCAGAGGCTGGGCCCAGAATACATAAGTAGCCGCATGGCTGGCGGAGGCCAGAAGGTGTGCTACATTGAGGGTCATCGGGTAATTAATCTGGCCAATGAGATGTTTGGTTACAATGGCTGGGCACACTCCATCACGCAGCAGAATGTGGATTTTGTTGACCTCAACAATGGCAAGTTCTACGTGGGAGTCTGTGCATTTGTGAGGGTCCAGCTGAAGGATGGTTCATATCATGAAGATGTTGGTTATGGTGTTAGTGAGGGCCTCAAGTCCAAGGCTTTATCTTTGGAGAAGGCAAGGAAGGAGGCGGTGACAGACGGGCTGAAGCGAGCCCTCAGGAGTTTTGGGAATGCACTTGGAAACTGTATTCTGGACAAAGACTACCTGAGATCACTAAATAAGCTTCCACGCCAGTTGCCTCTTGAAGTGGATTTAACTAAAGCGAAGAGACAAGATCTTGAACCGTCTGTGGAGGAGGCAAGATACAACAGCTGCCGACCGAACATGGCCCTGGGACACCCACAGCTGCAGCAGGTGACCTCCCCTTCCAGACCCAGCCATGCTGTGATACCGGCGGACCAGGACTGCAGCTCCCGAAGCCTGAGCTCATCCGCCGTGGAGAGCGAGGCCACGCACCAGCGGAAGCTCCGGCAGAAGCAGCTGCAGCAGCAGTTCCGGGAGCGGATGGAGAAGCAGCAGGTTCGAGTCTCCACGCCGTCAGCTGAGAAGAGTGAGGCAGCGCCTCCGGCCCCTCCTGTGACGCACAGCACTCCTGTAACTGTCTCAGAACCACTCCTGGAGAAAGACTTCCTTGCAGGAGTGACTCAAGAATTAATCAAGACTCTTGAAGACAACTCTGAAAAGTGGGCTGTGACTCCCGATGCAGGGGATGGTGTGGTCAAGCCCTCGTCTAGAGCAGACCCAGCCCAGACCTCTGACACATTAGCCTTGAACAACCAGATGGTGACCCAGAACAGGACTCCACACAGCGTTTGCCACCAGAAACCACAAGCAAAATCTGGATCTTGGGACCTCCAAACTTATAGCGCTGACCAACGCACAACAGGAAACTGGGAATCTCATAGGAAGAGCCAGGACATGAAGAAAAGGAAATATGATCCATCTTAACTGAGGCTCAGGCCACATAATTGGACTCTGTCACAAAGGGACTTTGGAAAACTACTTTTTGGTCATGAAATTGTTCATCGCTGCTGGAGAATGAACGTCATTGCGATTTATCTTGCTTCATTCTGAACCTTATCAAGAGGATCTGACTGAGAGCCCACTGCAGTTAGAGCTGAGCACTTTTGAAAAGCTTGTCCATCACTCTAGTAGGGAGAGGCTCTGGACAGATGAATACCTTTTCTTCGGCTTGTGAGGCTTCCCACTATTTATTACTGAACTATTATGTAATGAAGATGGACATTTTAGGAATCACCAATGGCTCCTTGCCCTCAAGCAATATAGGCCAGACTTGGTCCTAAGCACCTGCCTCAGCAATTGTCTACATTCAGTTGTTTTGCATAACGTCTGCCTTCTTTCCTTTACGGTCCATGCCTTTAATGTTGCCCACATTAAGCACTGTGGATCACGACAGGAAAAAGGTTGGAGCAGTGCTTTTCACTACTTTGTATCAATCCAGGCTACAATCTTCATTTAATATAAATAATTTATGGATTTATGACATTACAATCCTGCATTGTTTCAAGACTGACATTTTTTCCTAAGGAAGGAAATAATCATCTAAGACCACGAAAAAAGGCTGTTTTTTGTTTTTTTTTTTTTTTTTTTTTTTGAGACGGGGTCTGGCTGTGTTGCCCTGACTGGAGTTCAGTGGTGCAAACACAGCTCTCTCCACAACCTCTTGGGCCCAAGTGATACTCCCACCTCTGCCTTACAAAATACAGGGATTACTGGTGTGAGCCACTGTGTCTGGCCAGAAAAGGCATTTTTGAGAAAGCAAATCGTATACCTTATTAACAAAATAGAATATATATATATTGCTTATCTGAAATGCTTGAAACCAGAATTGTTTTGCATTTTTTGAATATTTGTATACACATAATGAGACCTTGGGGATGGGACCCAAGTCTGAACGTGGAATTCACCTGTGTTTCGTGTATATGCCTCATACACATAATTTTGTGCATGAAACAGAGTTTTTGTATAAGAAGATACACTGCAGCTGAAGAGGGCTGGGTTTTTTTTTCTCTTAGGGTCGCTGCATAAACTGTTGTATGCCTGGTGCTTTGCGACTTGTCACACGAGGTCACGTGTGGAATTTTCCACTTCTGGCATCACGTCAGTGCTCAGAAATTTTCTGATCTCAGAGCATTTCAATTAGGGATGCTCAAACGCAACTGTTTCTACTTCCCCATTTCAGGTGTGAGATGTAACCCACCTTGACCATAAATTGGCTTTTCATAGTGCTCAGATGTTTCATAATTCTTCCCCCAAAATAATGAAGTTTGCAGTTTAACAACTTTTTTTTTGAGAGGGGGGGTCTGGCTCTGTAGCGCAGGCTGGAGTGCAGCGGTGCCATCTTGACTCATTGCAGCCTCCGCCTGCCAGGATTCAAGCAATTCTCCTGCCTCAGGCTCCCGAGTAGCTGGGATTACAGACACCCACCACGACGCCCGACTAATTTTTGTATTTTTAGTAGAGGAGACGGGGTTTCTCCATGTTGGCCAGGCTGGTCTCAAACTGACCTCAAGTGATCTGCCCACCTCGGCCTCCCAAAGTAAAAAGTACTAGAATTATAGGCATGAGCCATTGCGCCCAGCCAATTTAATAATTTTTTTAGACGTATTATTTTGGGCTGGGCTGTGGCTAATCTTGAAGCAGTGACTTCCTATTTTTTGGCTCAGACCCATTTGGGAAGCTGTGAACCTGAGATAAGGAAGTCTGAAAGTACTAGCCGGCAGCCGACCGTTTCTATTCCTTTCGAAGTTAAGGAGACAGCAAAGGAGCTCCCAGGAATTAGGGATCCAGTTATAAATTGCACTTAACTCAAAATAGTGCCAGTGAGAATGTGAAGGAATCTTCTGGAAATGAAACCCCACAGCTCAACAAAAGCAAGTTTGGTTTATTTGAATGGTTTCATTAAATAAGTCTACAAAGGTAACAAACTGAAGCACAAAGCGCAATCTTACAAGAAGCGCAACACCCAGAGTTAGTGCAAAATGTACAATTAACGGCTGCTGAGAAACCCCCAAAGTTTGAATTTTTATTTTTATTTTTAACAGTGTACATTGTTAAA

Folder name of your Data Dump for files on the CGCB

https://mega.hackteria.org/index.php/s/LZziaSLaiQ6D25t

Method(s) of Transgenesis

  • lipofection, including The Center for Alternative Coconut Research's 'Open Source and Topical' Lipofection Massage Cream or Liposomes (cationic) microspheres like they have in those RNA injectable vaccines

Safe Harbor(s)

Inducible Promoter

No inducible promoter this GOSPHA, thank you.

Reporter Genes

Resistance to persuasion, If you’re expressing a gene that may be toxic, it’s important that your inducible promoter not be too leaky. Trangenic humans with resistance to persuasion are known for their low leakiness.

Write draw or sketch what you think this gene will do to change human

super humans with super repair won't fix new mutations in genome, when they repair common DNA damage

Bioart Critic

Face it, the whole idea of super repair is actually full of issues! if repair can't occur with mistakes, for instance, we might lose immune system function (and who knows what else, as the immune system recombinase is also active in the BRAIN!!) in our putative 'superrepair' transgenic being!

Bioart Ethicist Review

poor little transgenic being... obviously orthogonal. chameleon and taxonomy issues are evident. what kind of story could it have to tell, if it can only do pure homologous recombination, no matter what? an archipelago of nonsense ready to be viewed... better not to see it at all…


CGCB_00002: Stinky (SnK2) WetNap (Wnp3k) aka bleuCheeze

Ready for review

Author(s)

  • Blue Cheese Mutant Gene Neuro Extension Omnipotence Factory Fun Team 2b (NEO-FFUN2b)
  • Neuro Extension Omnipotence Factory Fun (NEO-FFUN)

Gene Action

Causes neurodegeneration due to ceramide build up that disrupts cell autophagic processes

Your Genetic Sequence for the Creative Germline Constructs Bank (CGCB) of the Transgenic Human Genome Alternatives Project (thGAP_)

Drosophila melanogaster chromosome 2L NCBI Reference Sequence: NT_033779.5 GenBank Graphics >NT_033779.5:5907169-5922776 Drosophila melanogaster chromosome 2L

GCTGGAGAAAATTTGGTTCATATTTTCATACGTGAAACAAGATGTAAAACGAGTGCATTTAGGGCCCAAAATAGTGAAAACTCACACGGGAAACACAATGCTAGCGACGGATAGCAAAAGTAAGTGACGGCTGCACGAAATAAGCCGGAAAAGTGCATGTGAAAATTTTCAAATTCGACCTATCTGCTGGTTTGTTCAAGGGTGGGTGGCGGGCAGAGAGGCCGAGTGAGAGTACGCGAGAGAGGAAGAAAAATCAATAAAATTGTCGTGAGGCGCGATTGACTGGAGCAAAACAAAGTGCGACACGAAAGAGAGCGCTAAGCGGACTACGAAAAAGCAACAACAGAGCGGCCGTTAGCTGAACCAAATGCGTTGGCAGAAAAGAGAGGTCAGATAGTCGGTAGTTTCAAAGGGAGTTGGAGTAAACAAACAAGTGCGCAATAAGTAAACCAAGAACAGCTGTCTCGCACAAAATGTAAATATTTCCCGAATATATGGAATAATAACCACTATCGGTTAATCGCTTGCTCGCTATGTAGGCGTACGAATCGAATCGAGTCGGCGACAGAGGCAACGTTCATTCACTCGCGAAAAGTTAATACTCGCACCGAATACAATGATCGCACTTTTCGTGTGATTCACCTCCAGCGGCCGCTAATTAAGGCGGCGGCAGCAGAAATAGAATAGCTGCGAAAACAAGCCATAACGCCAACTGCACTGTGCGCGGTTGTGATTTGGAAGCCACTCAATTGAAAGTGTCAGTGCTGTGCAAATAAATCGCCAAAATATCTCACCTCCAATGTTCAAAAGATACAATATCTACAATAAGCACAGGTTCTATGGAAACATATGTTTAAATGCGAAGCGACACGTTTTGAACTGAAACCTGCATGAAAGTGGGAAAGTTCATTAAACTACAGCAGTAAAAAGTTTCAAAATACTATGAAATATCTTTTTACACCTTTATCGAATAATATATAATCTTTTTAAACGGCATAACATTGTAAACAAGTGAATCACCATTATTAAAACACATGTAGAAAGTGCCACCCCCTTGCAAAAAAATCAATGACATTCCTCATAGTACAGCCATTAGATTAGTCTTATATTTTGTATTAAGTCAACTTAATTTTCTCTCTTTTAGATTAATCTTACCGCAAATCAACAAACACAAAGATGAATGTAATGCGTAAGCTGCGCGGAGCGGCCAGCGCAGGCAGCGTCAGCGGCAGCAGTAGCGGAACCTCGACGGCGAACAACAGTTCACCAGGGAGCAGCAGAACGGATGCTGGTGCACCGACCGCTGCAAATGGACGGAATGCGGAGGAGGCGCTGATGGACGCCCGCGTCCAAGTGAGCCTCACCACGCTAAAGAAGCTATTCAACGAATACACTCATCCGCGGGAGCCGCTGAGCGAACAGGAGCGCGATGACAAGCTCTACGAGATGCTGCCCCTCTTCTGCAAAGTGAGTGAATCAGTCGGTATGGAGGAATAGGCCACTAACTCCCCATTCTTACAGGTCTTCAGCAGCTGTCCGTCAAACGACATGAGCGAAAAGTTCTGGGACGTGGTCGCCTTCTGCCAGCAAGTGTCCCGTCTCATGGTCAGCGAAATCCGCAAGCGCGCCTCCAACCAGAGCACAGAGGCGGCATCCATTGCCATAGTCAAGTTTCTCGAGGTGGAAACCACCGAGGAAACCAGCAGCGGATGGATGCTTTTGGCTACCCTCAATTTGTTGGCCAATGGAGACGTATCTCTCATACAGGTATGTTTCATTTATAAACTGCTATAGTATCTTATGGTAAAAATACATCGACGTAATCAAAACAAAAAATTTCAATAGCTACAATTTTCGTTAGGGAAAGTCGTCATCAAATTCACGAAGTTTTCTCAGTTCCAGGCTTCAAAGAGAATTCGATGTGTGAGTTCGTAGCTTCTTCATTTGTAATATTTGGGTTGGCTGCATCTGGAACTTGTTGTTCCTTTTCTCCCGCATCGCTTGGCTTATGGACCAATTCAGCATTGCTTAAAGTTCTGAGCCGAGAATAGCTAGAGCCCTGTTCTACCAGCAAAATCTCCGATTTCTCCCTTTTCTCAGTGTCCGCCCACATGGAAGATCGCCGGGCTAGCTTCCGATCCATTTGAATGGGTTTCATTGTGGCCTCGCTGTTCTCACTTGACCGAGTTGAAACAAGGCTAACAGTGCTCCTGTCCTCGATTTTGGCCCACAAGCTCGAGGAATCGCTGGAGCCGCGCCAGGCTGAAGCAGACCTGCGCATCTTATTGGCCTGCTCTTCCATGTACACACTGTACTCCGTGTCCACCGGTGTGATATCCGATTCACTGGTGGTTATTGTTGGCGTTGATAGAAAACTCTCGTCACTCTCGATCTGATGCAGCGAAAAGAACTTTTTACGCGCATCCCCAATGAACTGCCACATGCGGACTATAAAGTGCGGCTGCTCCACCTCCGCGTTCGGCCGGAAGTACAGGATCTGAGAATTGGCCAACTTATAGTAGCACCTGCAGCATTTGCATAGAAAGTCGTCCACTGGCTTGGAAAGCACAAATAGCCCGGTTGAACCAGACTCTGTTCCCTCAAAGTACTTACGGCCAGTCGCCTGACGTTTCCAGTCGCCGGGTTCCATGCGCATCAGCAGGTCGAACACGTGGAACATGTGCATCAGGTACATGGTGCCAGTAACCAGCGCAGCGATGCTCTGCTGCTTGCAGTGCGCAAAGTGCGGATGTTCCAGATACTCGATGGTAGAATTGATGAAGGCCAGGTGAGGGTCCAGCATGGCGGTGCGCATTATCAGCACGCCGCAGAAATAGTGCGACAGCACGGCACTCAGTGTGAGCAGGAGCTGGGAGGAGAGCACCGTACTCCTAGCCAATAGCAGTCGGAACGCGCCTAGAGCGGCGAGCGCCGTAAAGGACGAAAATGTGGCACAATATAGGATCACATGAGGAGTACGCTCTGGCCAGTAGGATGAGCCGCGTATGTGGAAAAACATACAAACACTGCCCAGCAACACCTCGATGAGTTTAAAAAACACCCAAACCTGGTTCATTTCACAGACGTATTCTAGTTTAAAATGGTTTAGATTTAGTTTTGGCAACAGATGAAAAAGGTTCTGCGGGAAAAGTTGTATCTCAAAATACAAAACACCGCCGGGGCTGCGGGCTTAAATTAAGATGTTAAATCTAAACTAACTAAGCAATTCTAATATTGCTGCATTTCAGGTCATGACTGCTGCGGCGGTTCCCTCTACTTTAGTGAAGTGCTTGTACTTGTTCTTCGACCTGCCCATAGTTGAGGACGATGAGCCTTCAGCTGACGGTGGAGCAGTAAGTGAGTTTAATGCCCATGAAAGGCGGACGCTTCTGCAGAAGGTGTTTGTGCAGCTGCTGGTCAAGCTGTGCTCGTATCCGTATCCCGCTGAGGAACTAGCTCGCATGGACGACTTGACGCTGCTATTCTCGGCCATCACATCGCCATGTCCCATCCACAATATTGTATGGCGCAAGAACGCAGCTGAAATCCTGACCACAATATCAAGGAATGGCCTAACCGATGCCGTAGTTAGCTATATACATTGTAAGTATGGTGGACTTAATCATTATGACTAAATATTCTTAAAATGTTTCTTAATTTAGCCAAGGGCTGCATGGCACTTTGCGTGGACAATATGCAGCGCCTGACGTTTGGAAATCCTTTGGAGATCGTTGAAATGTTCGTCACCGTGTTCTGCTTTCTCAAGGACTCCAGTCAGGT 

full text in Sequence Blue Cheese.md in https://mega.hackteria.org/index.php/s/3agCCG5BKJLpFE5

https://mega.hackteria.org/index.php/s/bpwxjJqCzNCwcr6

Folder name of your Data Dump for files on the CGCB

https://mega.hackteria.org/index.php/s/7Q3zdk8z8nTCdNb

Method(s) of Transgenesis

  • recombinant viruses (sometimes called biological nanoparticles or viral vectors), for instance: adeno-associated viruses (AAVs) (relative of herpes), oncoretroviral, lentiviral retroviruses (i.e. human immunodeficiency virus (HIV), which causes AIDS), adenoviruses, herpes simplex, vaccinia (pox), and human foamy virus.
  • biolistics
  • lipofection, including The Center for Alternative Coconut Research's 'Open Source and Topical' Lipofection Massage Cream or Liposomes (cationic) microspheres like they have in those RNA injectable vaccines
  • HAC, Human Artificial Chromosome also known as the MicroChromosome or #47
  • aerosol/colonic: on or in mucosal surfaces, such as up the nasal and inhaled into lung mucosa or enema/pneumatic (jet) injection

Safe Harbor(s)

  • HsROSA26;
  • subRosa, (sRs), the subRosa "safe" harbor name honors feminist pioneers in art, activism, labor, science, and politics: Rosa Bonheur, Rosa Luxemburg, Rosie the Riveter, Rosa Parks and Rosie Franklin.;
  • Kiy-gh Knock-in [your gene here] designed to Knock-out the gene for gullibility (GUL) during mutagenesis.

Inducible Promoter

chocolate fart olfactory promoter responds to chocolate farts; pLac promoter: eat or bathe in milk, cheese or yogurt and your gene turns on; Synth Cassette-optimized gene control with new inducer(s) of choice, i.e. the sound of frogs or popular condiments like mustard or sriracha mayonnaise, preventing off-target expression and reducing potential side effects of the treatment.; UBC Human ubiquitin C promoter, Ubiquitous in many ways.

Reporter Genes

Internal Reporter or Marker Genes: RAPD and SSCP, also for for DNA barcoding and Marker-assisted selection, gene mapping, genetic disease analysis and diagnosis. and genetic screening; human dopamine X37 reporter gene, warning head rush; tattletale (TTLTL) DNA that codes for reporter protein molecules; herbicide glyphosate resistance, may inhibit human photosynthesis in some cell types

Write draw or sketch what you think this gene will do to change human

Glycolipid mutants cause neurodegeneration and cholesterol amperage but the flies are also noticeably more giddy and randy. In humans this might lead to salty ceramides or with overexpression of nonMutant Bleu C~heese we might have less neurodegeneration and cholesterol reduction but also humans noticeably less giddy and randy, more lame with increased life span and expensive greasy synapses. Think slick, neuro-oil.

Bioart Critic

Bioart Ethicist Review

CGCB_00003:

to be knitted

Author(s)

Gene Action

Your Genetic Sequence for the Creative Germline Constructs Bank (CGCB) of the Transgenic Human Genome Alternatives Project (thGAP_)

Folder name of your Data Dump for files on the CGCB

Method(s) of Transgenesis

Safe Harbor

Inducible Promoter

Reporter Genes

Write draw or sketch what you think this gene will do to change human

Bioart Critic

Bioart Ethicist Review

CGCB_00004:

to be knitted

Author(s)

Gene Action

Your Genetic Sequence for the Creative Germline Constructs Bank (CGCB) of the Transgenic Human Genome Alternatives Project (thGAP_)

Folder name of your Data Dump for files on the CGCB

Method(s) of Transgenesis

Safe Harbor

Inducible Promoter

Reporter Genes

Write draw or sketch what you think this gene will do to change human

Bioart Critic

Bioart Ethicist Review